Welcome to Subscribe On Youtube
187. Repeated DNA Sequences
Description
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.
- For example,
"ACGAATTCCG"is a DNA sequence.
When studying DNA, it is useful to identify repeated sequences within the DNA.
Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
Example 1:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" Output: ["AAAAACCCCC","CCCCCAAAAA"]
Example 2:
Input: s = "AAAAAAAAAAAAA" Output: ["AAAAAAAAAA"]
Constraints:
1 <= s.length <= 105s[i]is either'A','C','G', or'T'.
Solutions
Solution 1: Hash Table
We define a hash table $cnt$ to store the occurrence count of all substrings of length $10$.
We iterate through all substrings of length $10$ in the string $s$. For the current substring $t$, we update its count in the hash table. If the count of $t$ is $2$, we add it to the answer.
After the iteration, we return the answer array.
The time complexity is $O(n \times 10)$, and the space complexity is $O(n \times 10)$. Here, $n$ is the length of the string $s$.
A => binary: 00
C => binary: 01
G => binary: 10
T => binary: 11
Basically, this questions is more of a compression problem, how to encode the 10-char string to use less disk space.
- plain char is 8 bits (2 bytes)
- encoding to 2 bits (00,01,10,11)
Solution 2: Rabin-Karp String Matching Algorithm
This method essentially combines sliding window and hash. Similar to 28 Find-the-Index-of-the-First-Occurrence-in-a-String. Find the Index of the First Occurrence in a String, this problem can use a hash function to reduce the time complexity of counting subsequences to $O(1)$.
The time complexity is $O(n)$, and the space complexity is $O(n)$. Here, $n$ is the length of the string $s$.
-
class Solution { public List<String> findRepeatedDnaSequences(String s) { Map<String, Integer> cnt = new HashMap<>(); List<String> ans = new ArrayList<>(); for (int i = 0; i < s.length() - 10 + 1; ++i) { String t = s.substring(i, i + 10); if (cnt.merge(t, 1, Integer::sum) == 2) { ans.add(t); } } return ans; } } -
class Solution { public: vector<string> findRepeatedDnaSequences(string s) { unordered_map<string, int> cnt; vector<string> ans; for (int i = 0, n = s.size() - 10 + 1; i < n; ++i) { auto t = s.substr(i, 10); if (++cnt[t] == 2) { ans.emplace_back(t); } } return ans; } }; -
class Solution: def findRepeatedDnaSequences(self, s: str) -> List[str]: words = set() # for encoded words repeated = set() # for encoded words result = [] # not encoded words # A => binary: 00 # C => binary: 01 # G => binary: 10 # T => binary: 11 mapping = {'A': 0, 'C': 1, 'G': 2, 'T': 3} for i in range(len(s) - 9): v = 0 for j in range(i, i + 10): # every time, use the new 2 bits after shifting for current char v <<= 2 v |= mapping[s[j]] if v in words and v not in repeated: repeated.add(v) result.append(s[i:i + 10]) words.add(v) return result ############ class Solution: def findRepeatedDnaSequences(self, s: str) -> List[str]: n = len(s) - 10 cnt = Counter() ans = [] for i in range(n + 1): sub = s[i : i + 10] cnt[sub] += 1 if cnt[sub] == 2: ans.append(sub) return ans -
func findRepeatedDnaSequences(s string) (ans []string) { cnt := map[string]int{} for i := 0; i < len(s)-10+1; i++ { t := s[i : i+10] cnt[t]++ if cnt[t] == 2 { ans = append(ans, t) } } return } // Solution 2 func findRepeatedDnaSequences(s string) []string { hashCode := map[byte]int{'A': 0, 'C': 1, 'G': 2, 'T': 3} ans, cnt, left, right := []string{}, map[int]int{}, 0, 0 sha, multi := 0, int(math.Pow(4, 9)) for ; right < len(s); right++ { sha = sha*4 + hashCode[s[right]] if right-left+1 < 10 { continue } cnt[sha]++ if cnt[sha] == 2 { ans = append(ans, s[left:right+1]) } sha, left = sha-multi*hashCode[s[left]], left+1 } return ans } -
function findRepeatedDnaSequences(s: string): string[] { const n = s.length; const cnt: Map<string, number> = new Map(); const ans: string[] = []; for (let i = 0; i <= n - 10; ++i) { const t = s.slice(i, i + 10); cnt.set(t, (cnt.get(t) ?? 0) + 1); if (cnt.get(t) === 2) { ans.push(t); } } return ans; } -
/** * @param {string} s * @return {string[]} */ var findRepeatedDnaSequences = function (s) { const cnt = new Map(); const ans = []; for (let i = 0; i < s.length - 10 + 1; ++i) { const t = s.slice(i, i + 10); cnt.set(t, (cnt.get(t) || 0) + 1); if (cnt.get(t) === 2) { ans.push(t); } } return ans; }; -
public class Solution { public IList<string> FindRepeatedDnaSequences(string s) { var cnt = new Dictionary<string, int>(); var ans = new List<string>(); for (int i = 0; i < s.Length - 10 + 1; ++i) { var t = s.Substring(i, 10); if (!cnt.ContainsKey(t)) { cnt[t] = 0; } if (++cnt[t] == 2) { ans.Add(t); } } return ans; } } -
use std::collections::HashMap; impl Solution { pub fn find_repeated_dna_sequences(s: String) -> Vec<String> { if s.len() < 10 { return vec![]; } let mut cnt = HashMap::new(); let mut ans = Vec::new(); for i in 0..s.len() - 9 { let t = &s[i..i + 10]; let count = cnt.entry(t).or_insert(0); *count += 1; if *count == 2 { ans.push(t.to_string()); } } ans } }